CORONAVIRUS: DIAGNÓSTICO Y TERAPIA EN HUMANOS

VolverVolver

Resultados 89 resultados LastUpdate Última actualización 07/08/2020 [18:58:00] pdf PDF xls XLS

Solicitudes publicadas en los últimos 365 días/Published applications in the last 365 days



Página1 de 4 nextPage   por página


DEVICES AND METHODS FOR REDUCING INFLAMMATION USING ELECTRICAL STIMULATION

NºPublicación: US2020238085A1 30/07/2020

Solicitante:

SPARK BIOMEDICAL INC [US]

Resumen de: US2020238085A1

Systems and methods for reducing pulmonary inflammation and/or increasing bronchial compliance in a patient utilize transcutaneous stimulation of neural structures in a region of an ear of a patient delivered by an auricular stimulation device having an in-ear component with a first electrode disposed in a patient's ear and an earpiece component with a second electrode placed around the auricle. A pulse generator may control delivery of therapy by delivering both a first series of stimulation pulses to the first electrode for stimulating a first neural structure(s) and a second series of stimulation pulses to the second electrode for stimulating second neural structure(s). The first and second electrodes are in non-piercing contact with tissue on and/or surrounding the ear. The systems and methods may be used to treat viral or bacteria infections, such as SARS, MERS, or COVID-19.

traducir

GREEN HUMAN RESOURCE MANAGEMENT PRACTICES FRAMEWORK FOR HEALTHCARE ORGANIZATIONS UNDER STRESSFUL COVID-19

NºPublicación: AU2020101189A4 30/07/2020

Solicitante:

A VELSAMY MR [IN]
A S SATHISHKUMAR DR [IN]
B RAJNARAYANAN MR [IN]
K SONIYA DR [IN]
K SRINIVASAN MR [IN]
M S SURESHKUMAR DR [IN]
P KARTHIKA DR [IN]
P KARTHIKEYAN DR [IN]
T NARAYANASWAMY DR [IN]

Resumen de: AU2020101189A4

GREEN HUMAN RESOURCE MANAGEMENT PRACTICES FRAMEWORK FOR HEALTHCARE ORGANIZATIONS UNDER STRESSFUL COVID-19 Abstract Over the years, organizations are facing pressure from various stakeholders to adopt environment-friendly green practices that boost sustainability during non-epidemic situations itself. Even though there are a lot of scopes available for green practices, but the development of green human resource management is slow. This work aims to calculate the level of real-time implementation of green human resource management practices in a healthcare organization and their performance during covid19. Various research approaches are adopted by conducting so many structured interviews with operational managers, human resource managers, and chief executive officers within a range of areas in the healthcare sector in India during covid19. Data collection was done as a quantitative tool for various managerial levels where green management practices are done. For data analyses purpose, partial least squares structural equation modeling is used. The most compelling green acts of ID and prioritization were green employing and green preparation and contribution. Green execution the executives and remuneration are the least many green practices. A system has been created to give covid19 strategy creators set of rules on the best way to impact and actualize green human assets the executives rehearses to increase most extreme exhibitions. If the covid19 supportable presentation exec

traducir

METHOD FOR DETECTING CDNA OF SARS-COV-2 CORONAVIRUS USING SYNTHETIC OLIGONUCLEOTIDE PRIMERS IN POLYMERASE CHAIN REACTION

NºPublicación: RU2727054C1 17/07/2020

Solicitante:

DROZD SERGEJ FELIKSOVICH [RU]

Resumen de: RU2727054C1

FIELD: biotechnology.SUBSTANCE: described is a method for detecting cDNA of SARS-CoV-2 virus. Use of specific primers allows detecting genetic material of SARS-CoV-2 virus in analyzed samples by polymerase chain reaction (PCR). One pair of primers is selected to orf1ab gene. Their sequences: SEQ ID NO: 1-5' cagtctgtaccgtctgcgg 3', SEQ ID NO: 2-5' cagtactagtgcctgtgccg 3'. Length of amplicon is 158 base pairs. Two pairs of primers are selected to gene N. Their sequences and length of amplicons: SEQ ID NO: 3-5' ggtggaccctcagattcaactgg 3', SEQ ID NO: 4-5' ttttaccgtcaccaccacgaa 3', PCR product length is 250 base pairs; SEQ ID NO: 5-5' cgcattggcatggaagtcac 3', SEQ ID NO: 6-5' tgtctctgcggtaaggcttg 3', PCR product length is 203 base pairs. After PCR, reaction products are separated in electrophoresis with marker length. According to the presence and length of amplicons, the method enables detecting and identifying the presence of SARS-CoV-2 virus in biological material.EFFECT: invention can find application in medicine in laboratory diagnostics COVID-19.1 cl, 2 dwg, 4 tbl, 2 ex

traducir

MERS-CoV Vaccine

NºPublicación: US2020222527A1 16/07/2020

Solicitante:

UNIV PENNSYLVANIA [US]
INOVIO PHARMACEUTICALS INC [US]

US_2019022213_A1

Resumen de: US2020222527A1

Disclosed herein is a vaccine comprising a Middle East Respiratory Syndrome coronavirus (MERS-CoV) antigen. The antigen can be a consensus antigen. The consensus antigen can be a consensus spike antigen. Also disclosed herein is a method of treating a subject in need thereof, by administering the vaccine to the subject.

traducir

PROBIOTIC WHICH CURES COVID 19 PATIENTS BY TRANSFER OF NATURAL PASSIVE IMMUNITY FROM IMMUNISED COWS

NºPublicación: WO2020143892A2 16/07/2020

Solicitante:

LACHLAK NASSIRA [DZ]
BENSEBTI ISHAQ [DZ]

Resumen de: WO2020143892A2

The invention relates to a technique for the transfer of natural passive immunity via the colostrum of gestating cows infected with SARS-COV-2. These COVID19 cows developed immunity, producing colostrum rich in anti-SARS-COV-2 IgG antibodies. This colostrum is a natural probiotic of the immunised cow having circulating anti-SARS-COV-2 antibodies which is curative and preventive for patients infected with COVID19 and healthy patients. The worsening of cases is found in patients with serious pathological conditions and patients who are overweight. SARS-COV-2 infection causes severe respiratory distress ending up in intensive care; feeding can be done using a feeding tube, the viral load is stopped by this probiotic, but the prognosis is poor from the pulmonary and cerebral point of view. COVID19 patients who have recovered develop anti-SARS-COV-2 antibody immunity that can be seen in the serological test. This colostrum is stored using a cold lyophilisation technique which makes it possible to keep the anti-SARS-COV-2 IgGs 99% viable.

traducir

LAMP New primer set for detection of MERS-coronavirus using LAMP and uses thereof

NºPublicación: KR102133995B1 14/07/2020

Solicitante:

한국식품연구원한국화학연구원

Resumen de: KR102133995B1

본 발명은 LAMP를 이용한 메르스 코로나바이러스 검출용 신규 프라이머 세트 및 이의 용도에 관한 것으로, 구체적으로는 Nsp1 유전자 및 Orf5 증폭하기 위한 고리매개등온증폭 (LAMP) 반응용 프라이머 세트; 이를 포함하는 검출용 조성물; 검출용 키트; 및 이를 이용한 검출방법에 관한 것이다. 본 발명에 따른 LAMP를 이용한 메르스 코로나바이러스 검출용 신규 프라이머 세트; 이를 포함하는 검출용 조성물; 검출용 시트; 및 이를 이용한 검출방법을 사용하면, 메르스 코로나 바이러스를 현장에서 직접 고가의 장비 없이 매우 간편하고 쉽게 빠르게 검출할 수 있다. 또한 민감도 또한 매우 높아, 메르스 코로나바이러스 감염의 확진에 매우 유용하게 사용될 수 있을 것이다.

traducir

DETECTION OF COVID-19

NºPublicación: US2020214649A1 09/07/2020

Solicitante:

COGLEY THOMAS PAUL [US]

Resumen de: US2020214649A1

The steps of the method are: providing a generator adapted to produce specific wavelengths to maximize light emissions; providing a scintillator in operative proximity to the generator, the scintillator having an associated scintillator screen of a specific phosphor or other excitive type sensitive to various wavelengths, the scintillator being sensitive to a wavelength that maximizes light emissions; positioning a patient to be diagnosed between the generator and the scintillator; emitting a specific wavelength from the generator to and through the patient onto the scintillator screen whereby the associated scintillator screen will light up and sparkle to produce a light image of the patient; providing a camera in operative proximity to the scintillator screen to record the light image produced on the scintillator screen; providing a computer with a computer screen and software; capturing and analyzing the recorded light images from the camera; and obtaining a diagnosis for treatment of the patient.

traducir

Peptides having protease activity for use in the treatment or prevention of coronavirus infection

NºPublicación: AU2019205602A1 09/07/2020

Solicitante:

ENZYMATICA AB

WO_2019135003_PA

Resumen de: AU2019205602A1

The present invention provides a polypeptide having protease activity for use in the treatment or prevention of coronavirus infection in a mammal. In particular, the invention relates to treatment or prevention of a coronavirus infection in a human, using trypsins.

traducir

Bubbles for air decontamination

NºPublicación: GB2580006A 08/07/2020

Solicitante:

MICHAEL ANTHONY HOLMES [GB]

Resumen de: GB2580006A

A method of decontaminating air from lipophilic airborne contaminants (e.g. lipid enveloped virus) comprising delivering soap bubbles into the air, wherein the soap bubbles comprise a solvent and a surfactant. Preferably the surfactant is sodium laureth sulphate and/or sodium lauryl sulphate. The soap bubbles may further comprise an evaporation suppressant such as glycerol, polyethylene glycol and/or corn syrup. In one embodiment the lipophilic airborne contaminants are lipid-coated viruses, such as coronaviruses like COVID-19. The method can be computer-implemented and comprises a decontamination signal transmitter which transmits a wired or wireless decontamination activation signal to the air decontamination apparatus, which in response, produces and delivers soap bubbles into the air. There may optionally be a decontamination deactivation signal which ceases production of the soap bubbles.

traducir

DETECTION OF SARS-COV-2 IN A PLURALITY OF BIOLOGICAL SAMPLES

NºPublicación: EP3670669A1 24/06/2020

Solicitante:

DRK BLUTSPENDEDIENST BADEN WUERTTEMBERG HESSEN GEMEINNUETZIGE GMBH [DE]

Resumen de: EP3670669A1

The invention is directed to a method for the detection of SARS-CoV-2 in a plurality of biological samples of living beings and to a kit for carrying out said method.

traducir

USE OF DIACEREIN IN PREPARATION OF ANTIVIRAL DRUGS AND TREATMENT OF VIRUS INFECTIONS

NºPublicación: WO2020114444A1 11/06/2020

Solicitante:

CHINA INSPECTION SCIENCE PHARMACEUTICAL BEIJING GROUP CO LTD [CN]

CN_111265508_A

Resumen de: WO2020114444A1

Pharmaceutical use of diacerein. Experiments show that diacerein can effectively inhibit hepadnavirus, retrovirus, enterovirus, orthomyxovirus, filovirus, reovirus, arenavirus, hepatitis E virus, astrovirus, orbivirus, coronavirus, parvovirus, adenovirus, polyomavirus, herpes virus, poxvirus, human papilloma virus, paramyxovirus, flavivirus, alphavirus, and rhabdovirus.

traducir

Method of Treating Coronavirus

NºPublicación: US2020179367A1 11/06/2020

Solicitante:

MYMD PHARMACEUTICALS INC [US]

US_2020179366_A1

Resumen de: US2020179367A1

In one aspect, a coronavirus is treated by administering a pharmaceutical composition containing a therapeutically effective amount of isomyosmine or a pharmaceutically acceptable salt thereof. In another aspect, oxidative stress is reduced in an individual suffering from a coronavirus by administering a pharmaceutical composition containing a therapeutically effective amount of isomyosmine or a pharmaceutically acceptable salt thereof. In another aspect, mitochondrial reactive oxygen species (mtROS) are inhibited in an individual suffering from a coronavirus by administering a pharmaceutical composition containing a therapeutically effective amount of isomyosmine or a pharmaceutically acceptable salt thereof. In one example, the coronavirus is Covid-19.

traducir

Method for producing Chinese hamster ovary cell strain, being a producer of recombinant SARS-CoV-2 virus protein RBD, Chinese hamster ovary cell strain, producer of recombinant SARS-CoV-2 protein RBD, method for producing recombinant SARS-CoV-2 virus protein RBD, test system for enzyme immunoassay of human serum or plasma, and use thereof

NºPublicación: RU2723008C1 08/06/2020

Solicitante:

FEDERALNOE GOSUDARSTVENNOE BIUDZHETNOE UCHREZHDENIE \u00ABNATSIONALNYI ISSLEDOVATELSKII TSENTR EPIDEMIOLO [RU]

Resumen de: RU2723008C1

FIELD: biotechnology.SUBSTANCE: The invention relates to the field of biotechnology. Created are a genetic construct for the expression of recombinant SARS-CoV-2 virus protein RBD, a strain of Chinese hamster ovary cells CHO-S-RBD that produces a recombinant protein - a receptor-binding domain (RBD) of SARS-CoV-2 virus, which can be used for diagnostic purposes. Described is a method for producing a strain of Chinese hamster ovary cells CHO-S-RBD being a producer of recombinant SARS-CoV-2 virus protein RBD, containing a genetic construct comprising SEQ ID NO: 1; introducing the specified genetic constructs into cells by lipofection; selecting cells on Hygromycin B antibiotic. Created is a strain of Chinese hamster ovary cells CHO-S-RBD, a producer of recombinant SARS-CoV-2 virus protein RBD. Developed is a method for producing recombinant SARS-CoV-2 virus protein RBD, comprising: culturing a strain of Chinese hamster ovary cells CHO-S-RBD; purifying chromatographically the recombinant SARS-CoV-2 virus protein RBD from culture medium of the Chinese hamster ovary strain CHO-S-RBD; confirming the production of recombinant SARS-CoV-2 protein RBD. Created is a recombinant SARS-CoV-2 virus protein RBD to detect antibodies to SARS-CoV-2. Created is a test system for enzyme immunoassay of human serum or plasma. Developed is a method for analyzing serum or plasma of COVID-19 convalescents to sample the most promising ones for treating patients infected with SARS-CoV-2. Developed is a

traducir

Quadruple Regime using Azithromycin 500mg daily plus Vitamin C gram twice daily plus Zinc 500mg daily plus Low-dose Aspirin 100mg daily for 12 weeks to be used as prophylaxis to prevent COVID-19 Virus / Corona Virus / SARS COVID 2 Virus infection in Nursing home / aged care population in Illawarra Region NSW Australia.

NºPublicación: AU2020100641A4 04/06/2020

Solicitante:

BALASUBRAMANIAM VAIDYANATHAN DR [AU]
THE TRUSTEE FOR VICTORIAN NEURO AND ORTHO REHAB SERVICES TRUST [AU]

Resumen de: AU2020100641A4

Abstract The present invention describes compositions comprising azithromycin, vitamin C, zinc and acetylsalicylic acid (Aspirin) for the treatment of fever; cough; diarrhoea and flu like symptoms.

traducir

SYSTEM AND METHOD FOR THE REMOVAL OF ALVEOLAR (THORAX) FLUIDS IN PATIENTS WITH INFECTIOUS AND/OR VIRUS DISEASES (COVID-19)

NºPublicación: NO20200436A1 03/06/2020

Solicitante:

MODI VIVENDI AS [NO]

TOV 770 - An innovative ethyl alcohol, chlorite, hydrogen peroxide, tea tree oil extract (Melaleuca alternifolia) based anti- SARS-CoV-2 (severe acute respiratory syndrome coronavirus 2) viral surface sanitizer

NºPublicación: AU2020100545A4 28/05/2020

Solicitante:

WHOLESALE GROUP INT PTY LTD [AU]

Resumen de: AU2020100545A4

Abstract An innovative ethyl alcohol, chlorite, hydrogen peroxide, tea tree oil extract (Melaleuca alternifolia) based anti- SARS-CoV-2 (severe acute respiratory syndrome coronavirus 2) viral surface sanitizer comprising of a mixture of biocidal agents: (a) Ethyl alcohol (contains an ethyl group [saturated two carbon moiety] is an alkyl substituent derived from ethane (C 2H)) comprising of 65-70 % w/w of the composition; (b) Sodium and/or Calcium Hypochlorite [Na(CIO)/Ca(CIO) 2 ] comprising of 0.1% w/w of the composition; (c) 0.5% hydrogen peroxide comprising of 0.1% w/w of the composition (d) 0.01% Tea Tree Oil Extract (Melaleuca alternifolia) w/w of the composition.

traducir

DIGNOSTIC KIT AND WHOLE GENOME SEQUENCE IDENTIFICATION METHOD WHICH USE AMPLIFICATION OF WHOLE GENOME OF HUMAN ALPHA CORONAVIRUS

NºPublicación: WO2020105873A1 28/05/2020

Solicitante:

KOREA RES INST STANDARDS & SCI [KR]

KR_20200060070_A

Resumen de: WO2020105873A1

The present invention relates to a method for obtaining a whole genome sequence for determining the presence of infection by coronavirus, and a use thereof. A method, a kit and a composition of the present invention comprise a set of 11 universal primers capable of amplifying the genomic sequence of coronavirus, thereby enabling easy and rapid identification of the presence of a target virus in a sample and related diseases. In addition, through whole genome sequencing, mutations of novel coronavirus can be identified so as to be effectively used in the identification of novel viruses.

traducir

TRIMERIC S1-CD40L FUSION PROTEIN VACCINE AGAINST MIDDLE EAST RESPIRATORY SYNDROME-CORONAVIRUS

NºPublicación: US2020164058A1 28/05/2020

Solicitante:

KING ABDULAZIZ UNIV [SA]

Resumen de: US2020164058A1

An immunogenic CD40-targeted trimeric MERS-CoV S1 fusion polypeptide as well as a corresponding polynucleotide encoding it and its use for safely inducing immune responses directed against MERS-CoV without inducing vaccine associated respiratory pathologies associated with non-targeted vaccines.

traducir

CORONAVIRUS IMPACT ON THE WORLD ECONOMY PROBLEMS SOLVING: I invent the equation for solving the forecast of number of COVID-19 cases in the future so to help a country can re open the business as early as possible in the minimizes of COVID-19

NºPublicación: AU2020100564A4 21/05/2020

Solicitante:

PHAN HUNG THANH MR [AU]

Resumen de: AU2020100564A4

A method of solving problems on the coronavirus impact on the world economy by forecasting and controlling the spread of the virus.

traducir

Immunobiological agent and method of use thereof for inducing specific immunity against the severe acute respiratory syndrome virus SARS-CoV-2 (embodiments)

NºPublicación: RU2720614C1 12/05/2020

Solicitante:

FEDERALNOE GOSUDARSTVENNOE BIUDZHETNOE UCHREZHDENIE \u00ABNATSIONALNYI ISSLEDOVATELSKII TSENTR EPIDEMIOLO [RU]

Resumen de: RU2720614C1

FIELD: biotechnology, immunology, virology.SUBSTANCE: The invention relates to the field of biotechnology, immunology and virology, in particular to an immunobiological agent for the prevention of diseases caused by the severe respiratory syndrome virus SARS-CoV-2. Also, a method is disclosed for inducing specific immunity to the SARS-CoV-2 virus, comprising administering one or more immunobiological agents to the mammalian body for the prevention of diseases caused by the severe respiratory syndrome virus SARS-CoV-2. The invention allows to effectively induce an immune response against SARS-CoV-2 virus.EFFECT: the invention allows to effectively induce an immune response against SARS-CoV-2 virus.10 cl, 5 dwg, 12 tbl, 15 ex

traducir

SET OF SYNTHETIC OLIGONUCLEOTIDES FOR DETECTING OF CORONAVIRUS RNA

NºPublicación: RU2720713C1 12/05/2020

Solicitante:

RUBALSKIJ EVGENIJ OLEGOVICH [RU]

Resumen de: RU2720713C1

FIELD: medicine; biology.SUBSTANCE: invention refers to medicine and biology, namely to detection of SARS-CoV-2 coronavirus RNA in samples of biological material of human and animals, as well as in samples of environmental objects. Described is a set of synthetic oligonucleotides for detecting of SARS-CoV-2 coronavirus RNA includes a pair of primers selected from: 5'-GGTAAGAGTCATTTTGCTATTGGCC-3' and 5'-CTTGTAAAGTTGCCACATTCCTACG-3'; 5'-GTAAGAGTCATTTTGCTATTGGCC-3' and 5'-TTGTAAAGTTGCCACATTCCTACG-3'; 5'-TAAGAGTCATTTTGCTATTGGCC-3' and 5'-TGTAAAGTTGCCACATTCCTACG-3'; 5'-AAGAGTCATTTTGCTATTGGCC-3' and 5'-GTAAAGTTGCCACATTCCTACG-3'; 5'-AGAGTCATTTTGCTATTGGCC-3' and 5'-TAAAGTTGCCACATTCCTACG-3'; 5'-TGAGTGAAATGGTCATGTGTGG-3' and 5'-AGACCTTGAGATGCATAAGTGC-3'. From a pair of selected primers, one oligonucleotide can have a fluorescent label. A set of synthetic oligonucleotides for detecting of SARS-CoV-2 coronavirus RNA can additionally contain a fluorescent labeled oligonucleotide probe complementary or partially complementary to a nucleotide sequence flanked by a selected pair of primers.EFFECT: technical result of the invention consists in providing universal information value of detecting of SARS-CoV-2 RNA based on RT-PCR by eliminating the risk of obtaining false-negative results of RT-PCR in the presence of mutations in the amplified region of the SARS-CoV-2 genome.3 cl, 7 ex

traducir

2019 LAMP LAMP composition for detecting 2019 novel Coronavirus and uses thereof

NºPublicación: KR102109196B1 11/05/2020

Solicitante:

THE ARMED FORCES MEDICAL COMMAND [KR]

Resumen de: KR102109196B1

본 발명은 2019 신종코로나바이러스(2019 novel Coronavirus) 검출용 LAMP(Loop-mediated isothermal amplification)용 조성물 및 이의 용도에 관한 것으로, 본 발명의 LAMP 조성물을 이용한 2019 신종코로나바이러스의 검출 방법은 시료로부터 별도의 핵산 추출 및 정제 과정 없이도 간단한 실시간 등온증폭기기만으로 분자진단 검사 결과를 현장에서 1시간 이내에 확인할 수 있으므로, 현장진단검사 등에 유용하게 활용될 수 있을 것이다.

traducir

Dual-loop-mediated isothermal amplification technology based probe for detecting novel coronavirus, primer, kit and detection method

NºPublicación: CN111088406A 01/05/2020

Solicitante:

MEDCAPTAIN MEDICAL TECH CO LTD

Resumen de: CN111088406A

The invention provides a dual-loop-mediated isothermal amplification technology based primer for detecting a novel coronavirus. The primer comprises a first primer group and a second primer group, wherein the first primer group comprises a first inner primer pair shown in SEQ ID. No. 3-4, a first outer primer pair shown in SEQ ID. No. 5-6 and a first loop primer pair shown in SEQ ID. No. 7-8; andthe second primer group comprises a second inner primer pair shown in SEQ ID. No. 9-10, a second outer primer pair shown in SEQ ID. No. 11-12 and a second loop primer pair shown in SEQ ID. No. 13-14.The first primer group and the second primer group can rapidly and specifically amplify different target genes of the novel coronavirus separately. The invention further provides a probe for detectingthe novel coronavirus, a kit and a method.

traducir

Kit for detecting coronavirus RNA and method for detecting coronavirus RNA

NºPublicación: CN111088407A 01/05/2020

Solicitante:

WUXI SHENRUI BIO PHARMACEUTICALS CO LTD

Resumen de: CN111088407A

The invention provides a kit for detecting coronavirus RNA and a method for detecting the coronavirus RNA. The kit for detecting the coronavirus RNA comprises the following components: nuclease Cas13a, Cas13a guide RNA used for specifically detecting SARS-CoV-1 gene sequence and SARS-CoV-2 gene sequence, a RNA fluorescence probe, reverse transcriptase, DNA polymerase, T7RNA polymerase, and a buffer. The kit for detecting the coronavirus RNA and the method for detecting the coronavirus RNA disclosed by the invention are capable of realizing specific detection on coronaviruses with the SARS-CoV-1 gene sequence and the SARS-CoV-2 gene sequence, and have the advantages of being easy to operate, high in sensitivity, strong in specificity, free of PCR amplification conditions, good in stability,economical, practical and the like; and thus, needs of rapid clinical diagnosis and screening can be met.

traducir

Non-contact face close-range air supply and exhaust device capable of preventing novel coronavirus pneumonia virus propagation

Nº publicación: CN111084943A 01/05/2020

Solicitante:

CHONGQING INDUSTRY POLYTECHNIC COLLEGE

Resumen de: CN111084943A

The invention relates to a non-contact face close-range air supply and exhaust device capable of preventing novel coronavirus pneumonia virus propagation. The non-contact face close-range air supply and exhaust device comprises a head ring, a temperature sensing probe, an air guide cylinder, an upper baffle and a connector. A connecting rod is arranged at the top end of the head ring; the temperature sensing probe is arranged at the outer end of the connecting rod; a cavity is formed in the air guide cylinder, an airflow through hole is formed in the inner ring, and the airflow through hole iscommunicated with the cavity; rotating shafts are arranged inside the two ends of the air guide cylinder; the rotating shafts are rotationally connected with the head ring; a joint is arranged on oneside of the head ring, an opening is formed in the outer side of the joint, and the opening is communicated with the cavity; the upper baffle and a lower baffle are arranged in the middle section ofthe air guide cylinder; a rotating groove is formed in the connector, and the connector is rotationally connected with the joint; an air guide pipe is arranged at the lower end of the connector; airflow in the air guide pipe can enter and exit from the airflow through hole through the connector, the joint and the cavity; and the air guide cylinder can rotate along center lines A of the rotating shafts. The non-contact face close-range air supply and exhaust device can provide guarantee for public t

traducir

Página1 de 4 nextPage por página

punteroimgVolver