Resumen de: CN122376742A
The invention relates to the technical field of biological medicines, and discloses medical application of HSPD1 acetylation modification in prevention or treatment of myocardial infarction. The invention discovers that the acetylation level of the K352 site of the HSPD1 protein is specifically up-regulated in the pathological process of myocardial infarction for the first time, the cardiac function after myocardial infarction can be remarkably improved by up-regulating the acetylation level of the site, and myocardial fibrosis and myocardial cell hypertrophy are inhibited; when the acetylation level of the site is reduced, myocardial ischemia injury can be aggravated, and the cardiac function can be deteriorated. According to the invention, HSPD1 K352 site acetylation can be used as a new target for prevention, treatment and auxiliary diagnosis of myocardial infarction, and a theoretical basis and an experimental basis are provided for research and development of myocardial infarction targeted drugs and gene therapy products.
Resumen de: CN122382188A
The invention provides application of maternal blood exosome miR-1909-3p as a biomarker in preparation of a product for diagnosis or auxiliary diagnosis of fetal congenital heart disease, and belongs to the technical field of in vitro diagnosis. According to the invention, miRNA microarray analysis is adopted to analyze the expression characteristics of the serum exosome microRNA in pregnancy affected by CHD compared with a matched healthy control. In the early pregnancy period and the late pregnancy period of TOF fetal pregnancy, the miR-1909-3p is remarkably overexpressed in maternal circulation, which indicates that the miR-1909-3p is a potential biomarker of the fetal congenital heart disease. Through verification set ROC curve analysis, it is found that the area under a curve is 0.953, Plt; the result shows that the miR-1909-3p can be used as a potential non-invasive biomarker for prenatal CHD screening, the sensitivity is 95%, and the specificity is 95%.
Resumen de: CN122351478A
The invention discloses medical application of UGDH in prevention or treatment of myocardial infarction, and belongs to the technical field of biological medicine. The invention firstly proves that UDP-glucose dehydrogenase (UGDH) plays a key regulation and control role in a myocardial infarction pathological process, and UGDH expression in a myocardial infarction model is remarkably up-regulated; the fibroblast specific knock-down UGDH can significantly improve the cardiac function of a mouse after myocardial infarction, reduce the myocardial infarction area, and inhibit myocardial fibrosis and fibroblast excessive activation; overexpression of UGDH significantly deteriorates the pathological phenotypes. According to the invention, UGDH can be used as a new target for prevention, treatment and auxiliary diagnosis of myocardial infarction, and a new direction is provided for development of gene therapy drugs for myocardial infarction.
Resumen de: CN122357716A
The invention discloses application of NT5C1A as a myocardial ischemia reperfusion injury treatment target, and belongs to the technical field of biological medicine. Through proteomics screening and in-vivo and in-vitro experiments, up-regulated expression of the NT5C1A in an MIRI pathological process is found and confirmed for the first time, and the NT5C1A is a key upstream factor for regulating and controlling an AMPK/SIRT1/PGC-1 alpha signal channel. Overexpression of the NT5C1A can effectively activate the pathway and cooperatively regulate multiple downstream pathological links: expression of mitochondrial fusion proteins Mfn-2 and OPA1 is promoted, and expression of split protein DRP1 is inhibited; aTP generation is obviously promoted, and energy metabolism disorders are improved; the expression balance of apoptosis-related protein Bax/Bcl-2 is adjusted, myocardial cell apoptosis is inhibited, and finally myocardial damage is relieved, the myocardial function is improved, and the myocardial infarction area is reduced. The invention provides a new target spot and strategy for accurate intervention of the MIRI.
Resumen de: CN122357712A
The invention provides application of an ApoL1 gene as an acute myocardial infarction diagnosis marker, and belongs to the field of gene functions and application. By detecting the expression level of APOL1 protein and mRNA in peripheral blood of an acute myocardial infarction (AMI) group and a healthy population group, it is found that the expression level of the APOL1 protein in the AMI group is 1.41 times that of the healthy population group, and the mRNA level of the APOL1 in the AMI group is 1.25 times that of the healthy population group. Compared with healthy people, the mRNA and protein levels of APOL1 in bodies of AMI patients are remarkably improved, and high expression of APOL1 is proved to be an independent risk factor of AMI and can be used as one of biomarkers for predicting AMI.
Resumen de: CN122351473A
The invention discloses application of SFRP3 in prevention and treatment of dilated cardiomyopathy, and belongs to the technical field of biological medicine. According to the application disclosed by the invention, the expression of SFRP3 in myocardial cells is reduced by means of gene interference, an RNA interference technology, an antibody or a small-molecule inhibitor and the like to treat dilated cardiomyopathy, so that the aims of improving cardiac functions, relieving cardiac dilation, improving myocardial fibrosis and effectively promoting myocardial repair are fulfilled; and a more effective treatment means with low side effect is provided for the treatment of dilated cardiomyopathy. The treatment thought provided by the invention not only can relieve the symptoms of the dilated cardiomyopathy, but also can regulate the physiological process of heart cells at the molecular level, and a new thought is provided for clinical treatment of the dilated cardiomyopathy.
Resumen de: CN122351428A
The invention relates to medical application of HSPB6 in prevention and treatment of vascular calcification, and belongs to the technical field of biological medicine. It is confirmed for the first time that the expression level of HSPB6 is in significant negative correlation with the vascular calcification process, HSPB6 overexpression can significantly inhibit vascular smooth muscle cell osteogenesis phenotypic transformation, in-vivo and in-vitro vascular calcium salt deposition is reduced, and occurrence and development of vascular calcification are delayed. On the basis, the invention provides application of an HSPB6 expression level detection reagent in preparation of vascular calcification auxiliary diagnosis products and application of an HSPB6 specific overexpression reagent in preparation of drugs for preventing and/or treating vascular calcification, and a new target and scheme are provided for early diagnosis and targeted prevention and treatment of vascular calcification.
Resumen de: CN122351250A
The invention discloses application of a substance which intervenes in the expression of a blood coagulation factor X (F10) or inhibits the activity of the blood coagulation factor X (FXa) activated in an activated form in preparation of a medicine for preventing or treating abdominal aortic aneurysm (AAA), and belongs to the field of biological medicine. It is found for the first time that endothelial-derived F10/FXa is significantly up-regulated in the early stage of AAA, and FXa can destroy the stability of endothelial tight junction protein ZO-1 through a non-blood-coagulation-dependent approach and drive the development of vascular wall barrier dysfunction and AAA. In-vivo experiments prove that the AAA tumor formation rate can be remarkably reduced by inhibiting F10 expression or FXa activity, aortic dilatation is inhibited, and a brand-new target spot and an intervention scheme are provided for early prevention and drug treatment of AAA.
Resumen de: CN122361809A
The present invention relates to compositions and methods for identifying risk patients and modulating thrombosis conditions in cancer patients. The embodiments provided herein include a method of determining the risk of a thrombosis event in a tumor patient, the method comprising: detecting an elevated level of PPIA, PDIA3, and at least one of EIF5A, EIF4H, EIF4a3, UBE2N, UBE2L3, UBE2I, and HSP70 in a sample of a cancer patient.
Resumen de: CN122357717A
The invention provides a collateral circulation biomarker MIA3 of a CTO patient and application of the collateral circulation biomarker MIA3, and belongs to the technical field of biology. The invention discloses and verifies that the plasma MIA3 level is remarkably positively correlated with the collateral circulation formation quality of a CTO patient, and the good collateral circulation prediction efficiency of the blood plasma MIA3 level is superior to that of a known vascular growth key factor VEGFA (Vascular Endothelial Growth Factor A). The MIA3 can serve as a high-value minimally invasive molecular marker and is used for noninvasively recognizing collateral circulation of a patient in the early stage before an interventional operation to form potential, so that risk stratification is carried out on the patient, and an objective basis is provided for making an individualized treatment decision (such as whether more positive intervention is needed or not). According to the application disclosed by the invention, the fact that MIA3 is a key link for regulating and controlling the collateral angiogenesis is clear, the activity of MIA3 is regulated up in a targeted manner, the collateral angiogenesis and maturation of an ischemic region can be accurately promoted, and a brand new non-drug and non-surgical treatment strategy is provided for CTO patients.
Resumen de: CN122351311A
The invention relates to the technical field of biology, in particular to broadleaf holly leaves, application of extracts of the broadleaf holly leaves and products for preventing or treating hypertension. The product has the following effects: the abundance of staphylococcus aureus (SA) in intestinal tracts is reduced or/and flora components are regulated; reducing the level in vivo of at least one exotoxin secreted by the SA; the expression of at least one of glutathione S-transferase and glutathione S-transferase P1 in paraventricular nucleus of hypothalamus is up-regulated. The invention also provides an application of the GSTM2/GSTP1 as a target spot in products for preventing or treating hypertension. The invention is further applied to prevention and treatment of hypertension by applying a product for up-regulating hypothalamic para-ventricular nucleus (PVN) antioxidant defense (GSTM2/GSTP1) through intestinal SA-exotoxin thereof. The invention provides a novel interventional antihypertensive target which is used for preparing novel drugs and other products for preventing and treating hypertension.
Resumen de: US20260193711A1
0000 Method of prediction of pregnancy complications associated with a high risk of pregnancy loss, such as miscarriage, stillbirth, or HELLP syndrome. Pregnant women are screened to determine the expression profile of two or more miRNAs in whole peripheral venous blood collected in the period of 10th-13th gestational week, whereas said two or more miRNAs are selected from the group miR-1-3p, miR-16-5p, miR-17-5p, miR-20a-5p, miR-26a-5p, miR-130b-3p, miR-143-3p, miR-145-5p, miR-146a-5p, miR-181a-5p, miR-195-5p, miR-210-3p, miR-342-3p, miR-499a-5p a miR-574-3p.
Resumen de: US20260191897A1
0000 The present disclosure provides methods of treating a subject having metabolic disorders and/or cardiovascular diseases, methods of identifying subjects having an increased risk of developing a metabolic disorder and/or a cardiovascular disease, and methods of detecting human Inhibin Subunit Beta E variant nucleic acid molecules and variant polypeptides.
Resumen de: WO2025046293A1
A method of assessing expression profiles of miRNA markers using predictive classification models to differentially diagnosing MMVD patients from healthy controls or DCM patients from healthy controls. Additionally, an assessment of the same method to discriminate pre-clinical from clinical MMVD or DCM patients. Also provided is a method of differentially diagnosing MMVD patients from DCM patients or from healthy controls.
Resumen de: CN122326737A
The invention belongs to the field of biomedical engineering, and relates to an application of SnoRNA Gm26330 as a myocardial hypertrophy biomarker and a therapeutic target. The invention provides a marker snoRNA (ribonucleic acid) Gm26330 related to myocardial hypertrophy, wherein the nucleotide sequence of the snoRNA Gm26330 is as shown in SEQ ID No. 1. The invention also provides a kit for detecting myocardial hypertrophy. In-vivo and in-vitro experiments show that the SnoRNA Gm26330 can inhibit the cardiac hypertrophy, the SnoRNA Gm26330 has a protection effect on myocardial damage caused by the cardiac hypertrophy, and the SnoRNA Gm26330 has a potential value for preparing the medicine for preventing and treating the related heart diseases.
Resumen de: CN122314366A
The invention relates to a group of genes related to gestational hypertension, a method for predicting gestational hypertension in early pregnancy by using the related genes and related application thereof. Specifically, a transcript starting site characteristic value of at least one of LOC124902572, EEF1A1P16, LOC105369767, GOLM2, CDRT7, MEIS3 and LOC105376108 in a to-be-detected pregnant woman cfDNA sample is obtained, and after the transcript starting site characteristic value is input into a prediction model, whether the risk of gestational hypertension exists or not is judged according to an output result. The initial site feature value of the transcript is the sequence number of the corrected transcriptional initial site region. The obtained prediction model can effectively and stably perform early prediction on the risk of gestational hypertension (including preeclampsia) in the early pregnancy so as to assist a doctor in performing early pregnancy intervention on a subject and reduce the occurrence risk of gestational hypertension.
Resumen de: CN122303422A
The invention relates to the field of biological medicine, and discloses a biomarker composition based on mitochondrial oxidative stress for auxiliary diagnosis of dilated cardiomyopathy and application of the biomarker composition. The biomarker combination comprises a TARS2 gene, a NOX4 gene and an SNCA gene. The biomarker combination can be applied to preparation of an auxiliary diagnosis kit for dilated cardiomyopathy, auxiliary diagnosis of dilated cardiomyopathy can be efficiently and accurately achieved by detecting the expression level of each gene in the biomarker combination, and compared with a traditional diagnosis means, the biomarker combination has the advantages that the sensitivity is high on the basis of mitochondrial oxidative stress related gene characteristics, and the sensitivity is high. The diagnosis accuracy is higher, and the applicability is better.
Resumen de: CN122297507A
The invention discloses an application of circFBXW4 in preparation of a medicine for treating cerebral apoplexy. The circFBXW4 inhibits FUS aggregation after cerebral arterial thrombosis and increases the free form of FUS by combining and adsorbing FUS, so that expression of downstream target protein HECTD1 and a ubiquitination substrate IQGAP1 of the downstream target protein HECTD1 is up-regulated, and then activation of astrocytes is inhibited. According to the application disclosed by the invention, the action mechanism of circFBXW4 in cerebral apoplexy diseases is systematically elaborated for the first time, and circFBXW4 is expected to become a novel biomarker and a molecular treatment target for clinically treating acute ischemic cerebral apoplexy.
Resumen de: CN122303424A
The invention discloses application of GGCX in preparation of a reagent for diagnosis or auxiliary diagnosis of cerebral arterial thrombosis. Firstly, by constructing a six-layer progressive genetics evidence system, it is proved that gamma-glutamyl carboxylase (GGCX) is up-regulated to the protection direction of cerebral arterial thrombosis, and the protection effect has subtype specificity. Secondly, constructing a diagnosis model based on peripheral blood GGCX expression data; and finally, verifying that the GGCX is obviously reduced under the ischemia condition through three aspects of clinical sample qPCR (quantitative polymerase chain reaction) detection, a tMCAO/R animal model and a primary hippocampal neuron OGD/R cell model, and clinically verifying that the AUC value of a queue is 0.889. The invention provides a reliable scheme based on the peripheral blood biomarker GGCX for early auxiliary diagnosis of cerebral arterial thrombosis. And the kit has definite clinical value and important significance for improving the early diagnosis rate of cerebral arterial thrombosis and shortening the time from morbidity to treatment.
Resumen de: CN122279030A
The invention discloses application of a reagent for detecting the expression level of pulmonary vessel tsRNA in preparation of a product for diagnosing and treating hypoxic pulmonary hypertension, the product and a pharmaceutical composition, and relates to the technical field of biomedicine, pulmonary vessel tsRNA is mt-tRF5-21-PheGAA, the nucleotide sequence of the mt-tRF5-21-PheGAA is GTTTATGTAGCTTACCTCCTC, the product comprises the reagent for detecting the expression level of tsRNA, and the reagent for detecting the expression level of tsRNA is applied to diagnosis and treatment of hypoxic pulmonary hypertension. The pharmaceutical composition comprises an activating agent of tsRNA, wherein the activating agent is an overexpression vector of mt-tRF5-21-PheGAA; according to the application of the pulmonary vessel tsRNA in diagnosis and treatment of the hypoxic pulmonary hypertension, the regulation effect of mt-tRF5-21-PheGAA on vascular remodeling caused by the pulmonary hypertension is defined, excessive proliferation of PASMCs is inhibited, pulmonary vascular remodeling and increase of the pulmonary hypertension are inhibited, and a new treatment target is provided for treatment of hypoxic PH through nucleic acid.
Resumen de: CN122278827A
The invention relates to the technical field of biological detection, in particular to a miRNA (micro Ribonucleic Acid) multi-modal detection array based on Mn-CeO2 (at) CDs nano enzyme and Cas12a sensing as well as a preparation method and application of the miRNA multi-modal detection array. The identification and signal amplification probe composition based on the Mn-CeO2 (at) CDs nano-enzyme and Cas12a comprises a solid-phase substrate, the DNA Y-type structure in the first aspect, the composite nano-enzyme and a CRISPR/Cas12a (clustered regularly interspaced short palindromic repeats/clustered regularly interspaced short palindromic repeats/clustered regularly interspaced short palindromic repeats) system. According to the invention, a DNA nanotechnology and a Cas12a enzyme digestion technology are combined, and nanoenzyme is used as a signal output medium. And the high-specificity and high-sensitivity multi-mode detection of the myocarditis marker miRNA in three modes of fluorescence, ultraviolet-visualization and electrochemistry is realized.
Resumen de: US20260176700A1
0000 The invention relates to an assay. More specifically, the invention relates to an assay for predicting cardiovascular toxicity of a chemotherapeutic agent.
Resumen de: US20260174904A1
0000 A B-cell specific octamer-binding protein 1 super-enhancer ribonucleic acid (BOB1-seRNA) and an application thereof are provided. The nucleotide sequence of the BOB1-seRNA is shown in SEQ ID NO: 1. Through experiments, it further confirms that the BOB1-seRNA is downregulated in patients with coronary heart disease and can be used in preparation of a product for diagnosing or predicting the coronary heart disease. The use of this molecular marker can be used for early diagnosis of the coronary heart disease, which is rapid and effective. It is not only of great significance for early treatment of the coronary heart disease and saving medical costs, but also provides therapeutic targets and important basis for clinical applications such as gene therapy and drug therapy.
Resumen de: CN122256497A
The invention discloses application of an intestinal bacterium metabolism key gene in preparation of an atherosclerosis diagnosis product, and belongs to the technical field of biological medicines. The invention establishes a CRISPR/Cas12a detection method based on RPA and crRNA array mediation, can accurately detect eight intestinal bacteria metabolism key genes closely related to cardiovascular diseases, and realizes rapid diagnosis according to the detection result. The invention provides a new technical means for evaluating the risk of cardiovascular diseases, and has potential application value in the aspects of early screening, prediction and judgment of diseases.
Nº publicación: KR20260094326A 22/06/2026
Solicitante:
서울대학교병원
Resumen de: KR20240114848A
The present invention relates to a marker composition, a kit, a panel, and a method for providing information for diagnosing, generating, or predicting prognosis of stroke. The present invention is a novel tool capable of predicting the diagnosis, occurrence, progress, or prognosis of a stroke. the present invention has excellent sensitivity and can be easily analyzed without using a biopsy, thereby being usefully used for early diagnosis, occurrence, or prognosis prediction of a stroke.