Si deseas distinguir tus productos, servicios o ambos de los de otra empresa, es posible que necesites una marca o nombre comercial. Descubre qué son, en qué consiste su procedimiento de registro y qué implica.
Información sobre los plazos de presentación de solicitudes de transformación de marcas de la Unión Europea en marca nacional española. Más información
Si tienes un nuevo dispositivo, producto o procedimiento que resuelva un problema técnico o tenga una ventaja práctica, existen distintas formas de protegerlo en España y en otros países. Descubre cómo hacerlo.
¿Tu innovación reside en la estética, la ornamentación o la apariencia de tu producto? Protégela mediante un diseño industrial. Descubre qué derechos confiere el registro y cómo realizar la tramitación.
Las indicaciones geográficas protegen el nombre de un producto originario de una zona geográfica, a la cual le debe una determinada calidad, reputación u otra característica. Descubre qué son, en qué consiste su procedimiento de registro y qué beneficios conceden.
Las patentes publicadas en todo el mundo son una valiosa fuente de información científica, técnica y comercial.
Si eres emprendedor/a o una empresa y quieres potenciar y mejorar la rentabilidad de tu negocio protegiendo de forma adecuada los activos intangibles de tu organización, en este espacio encontrarás lo necesario.
84
resultados
Última actualización
19/10/2026 [09:38:00]
Resultados 75 a 84 de 84
Resumen de: CN122303422A
The invention relates to the field of biological medicine, and discloses a biomarker composition based on mitochondrial oxidative stress for auxiliary diagnosis of dilated cardiomyopathy and application of the biomarker composition. The biomarker combination comprises a TARS2 gene, a NOX4 gene and an SNCA gene. The biomarker combination can be applied to preparation of an auxiliary diagnosis kit for dilated cardiomyopathy, auxiliary diagnosis of dilated cardiomyopathy can be efficiently and accurately achieved by detecting the expression level of each gene in the biomarker combination, and compared with a traditional diagnosis means, the biomarker combination has the advantages that the sensitivity is high on the basis of mitochondrial oxidative stress related gene characteristics, and the sensitivity is high. The diagnosis accuracy is higher, and the applicability is better.
Resumen de: CN122314366A
The invention relates to a group of genes related to gestational hypertension, a method for predicting gestational hypertension in early pregnancy by using the related genes and related application thereof. Specifically, a transcript starting site characteristic value of at least one of LOC124902572, EEF1A1P16, LOC105369767, GOLM2, CDRT7, MEIS3 and LOC105376108 in a to-be-detected pregnant woman cfDNA sample is obtained, and after the transcript starting site characteristic value is input into a prediction model, whether the risk of gestational hypertension exists or not is judged according to an output result. The initial site feature value of the transcript is the sequence number of the corrected transcriptional initial site region. The obtained prediction model can effectively and stably perform early prediction on the risk of gestational hypertension (including preeclampsia) in the early pregnancy so as to assist a doctor in performing early pregnancy intervention on a subject and reduce the occurrence risk of gestational hypertension.
Resumen de: CN122279030A
The invention discloses application of a reagent for detecting the expression level of pulmonary vessel tsRNA in preparation of a product for diagnosing and treating hypoxic pulmonary hypertension, the product and a pharmaceutical composition, and relates to the technical field of biomedicine, pulmonary vessel tsRNA is mt-tRF5-21-PheGAA, the nucleotide sequence of the mt-tRF5-21-PheGAA is GTTTATGTAGCTTACCTCCTC, the product comprises the reagent for detecting the expression level of tsRNA, and the reagent for detecting the expression level of tsRNA is applied to diagnosis and treatment of hypoxic pulmonary hypertension. The pharmaceutical composition comprises an activating agent of tsRNA, wherein the activating agent is an overexpression vector of mt-tRF5-21-PheGAA; according to the application of the pulmonary vessel tsRNA in diagnosis and treatment of the hypoxic pulmonary hypertension, the regulation effect of mt-tRF5-21-PheGAA on vascular remodeling caused by the pulmonary hypertension is defined, excessive proliferation of PASMCs is inhibited, pulmonary vascular remodeling and increase of the pulmonary hypertension are inhibited, and a new treatment target is provided for treatment of hypoxic PH through nucleic acid.
Resumen de: CN122278827A
The invention relates to the technical field of biological detection, in particular to a miRNA (micro Ribonucleic Acid) multi-modal detection array based on Mn-CeO2 (at) CDs nano enzyme and Cas12a sensing as well as a preparation method and application of the miRNA multi-modal detection array. The identification and signal amplification probe composition based on the Mn-CeO2 (at) CDs nano-enzyme and Cas12a comprises a solid-phase substrate, the DNA Y-type structure in the first aspect, the composite nano-enzyme and a CRISPR/Cas12a (clustered regularly interspaced short palindromic repeats/clustered regularly interspaced short palindromic repeats/clustered regularly interspaced short palindromic repeats) system. According to the invention, a DNA nanotechnology and a Cas12a enzyme digestion technology are combined, and nanoenzyme is used as a signal output medium. And the high-specificity and high-sensitivity multi-mode detection of the myocarditis marker miRNA in three modes of fluorescence, ultraviolet-visualization and electrochemistry is realized.
Resumen de: US20260174904A1
0000 A B-cell specific octamer-binding protein 1 super-enhancer ribonucleic acid (BOB1-seRNA) and an application thereof are provided. The nucleotide sequence of the BOB1-seRNA is shown in SEQ ID NO: 1. Through experiments, it further confirms that the BOB1-seRNA is downregulated in patients with coronary heart disease and can be used in preparation of a product for diagnosing or predicting the coronary heart disease. The use of this molecular marker can be used for early diagnosis of the coronary heart disease, which is rapid and effective. It is not only of great significance for early treatment of the coronary heart disease and saving medical costs, but also provides therapeutic targets and important basis for clinical applications such as gene therapy and drug therapy.
Resumen de: US20260176700A1
0000 The invention relates to an assay. More specifically, the invention relates to an assay for predicting cardiovascular toxicity of a chemotherapeutic agent.
Resumen de: CN122256497A
The invention discloses application of an intestinal bacterium metabolism key gene in preparation of an atherosclerosis diagnosis product, and belongs to the technical field of biological medicines. The invention establishes a CRISPR/Cas12a detection method based on RPA and crRNA array mediation, can accurately detect eight intestinal bacteria metabolism key genes closely related to cardiovascular diseases, and realizes rapid diagnosis according to the detection result. The invention provides a new technical means for evaluating the risk of cardiovascular diseases, and has potential application value in the aspects of early screening, prediction and judgment of diseases.
Resumen de: WO2026127584A1
The present invention relates to a biomarker for diagnosing or predicting the onset of postoperative acute kidney injury, and a method for diagnosing or predicting the onset of postoperative acute kidney injury using same. Specifically, the present invention relates to a method for diagnosing or predicting the onset of acute kidney injury by using, as a biomarker, miR-451a, miR-185-5p, miR-221-3p, miR-191-5p, miR-484, miR-144-3p, miR1972, miR-4478, miR-1273h-5p, miR-619-5p, miR-4430, or miR-548aq-3p in a blood sample following open-heart surgery.
Nº publicación: KR20260094326A 22/06/2026
Solicitante:
서울대학교병원
Resumen de: KR20240114848A
The present invention relates to a marker composition, a kit, a panel, and a method for providing information for diagnosing, generating, or predicting prognosis of stroke. The present invention is a novel tool capable of predicting the diagnosis, occurrence, progress, or prognosis of a stroke. the present invention has excellent sensitivity and can be easily analyzed without using a biopsy, thereby being usefully used for early diagnosis, occurrence, or prognosis prediction of a stroke.
BOPI
Sede Electrónica
